Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGC...
| Main Authors: | , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Nature Publishing Group
2018-10-01
|
| Series: | Nature Communications |
| Online Access: | https://doi.org/10.1038/s41467-018-06909-4 |