Suggested Topics within your search.
Showing 2,741 - 2,760 results of 2,853 for search '"restriction enzyme"', query time: 2.55s Refine Results
  1. 2741
    Prevalência do polimorfismo R72P no gene TP53 E C677T / A1298C do gene da metilenotetrahidrofolato redutase (MTHFR) em mulheres judias ashkenazi de Porto Alegre
    “... followed by digestion with specific restriction enzymes. The R72P polymorphism showed a genotype frequency...”
    Get full text
    Others
  2. 2742
    Clonagem, superexpressão, purificação e caracterização da proteína recombinante humana fator estimulador de colônias de granulócitos
    by Vanz, Ana Letícia de Souza
    Published 2013
    “... was assembled by PCR, Its amplicon was cloned into pET23a(+) expression vector using NdeI and BamHI, restriction...”
    Get full text
  3. 2743
    Variación genética intraespecífica de Echinococcus granulosus en la sierra central y sur del Perú
    “...-1, and then the genotyping was done with RFLP PCR using different cutting restriction enzymes. We...”
    Get full text
    Others
  4. 2744
    Microrganismos deteriorantes em vinhos e identificação de bactérias lácticas
    by Nunes, Márcia Menezes
    Published 2013
    “.... Were used kit API 50CHL bioMerieux®, restriction enzymes (endonucleases) to PCR/RFLP method...”
    Get full text
    Others
  5. 2745
    Incidência de enteroparasitas com caracterização molecular de Cryptosporidium spp. em diferentes comunidades brasileiras
    “... restriction enzymes. Double PCR confirmed Cryptosporidium in 37.2% (83/223) of the analyzed fecal samples...”
    Get full text
  6. 2746
    Detecção e identificação molecular de um fitoplasma do grupo 16SrIII em plantas de maçã com sintomas de lenho mole.
    by Luiz Fernando Caldeira Ribeiro
    Published 2004
    “...(III) F2/R1 primers and RFLP technique with the restriction enzymes Alu I, Hha I, Kpn I, Hinf I, Hpa...”
    Get full text
  7. 2747
    Variabilidade genética e ecológica de Drosophila willistoni (Diptera, Drosophilidae) : uma abordagem molecular através do isolamento e caracterização de fragmentos heterogêneos de DNA
    by Garcia, Rosane Nunes
    Published 2008
    “... of genomic DNA of males and females with the restriction enzymes AluI e HaeIII. These results demonstrated...”
    Get full text
    Others
  8. 2748
    Prevalência do polimorfismo R72P no gene TP53 E C677T / A1298C do gene da metilenotetrahidrofolato redutase (MTHFR) em mulheres judias ashkenazi de Porto Alegre
    “... followed by digestion with specific restriction enzymes. The R72P polymorphism showed a genotype frequency...”
    Get full text
    Others
  9. 2749
    Estudo molecular de genes envolvidos em disturbios de queratinização e perda auditiva
    by Alexandrino, Fabiana
    Published 2008
    “... and the mitochondrial mutation A7445G were performed using PCR were digested with specific restriction enzymes (Xba I...”
    Get full text
    Get full text
    Others
  10. 2750
    Análise do perfil de metilação do DNA em pacientes com e sem lesão de boca na paracoccidioidomicose
    by SINGI, Paola
    Published 2015
    “... extracted from whole blood of patients with and without oral lesions was digested with restriction enzymes...”
    Get full text
    Others
  11. 2751
    Isolamento e caracterização de clones da família de glicoproteínas (Tc-85) de Trypanosoma cruzi
    by Débora Rose de Oliveira
    Published 2000
    “...\') ATGTCCCGGCGTGTGTTTACTTCC and GPI-2 (3\') TCACAAAGTCGCAAAGCCCCACAGTCC was cut with restriction enzymes resulting...”
    Get full text
  12. 2752
    Caracterização molecular de dois begomovírus que infectam soja (Glycine max L. Merrill) e construção de um vetor viral para indução de silenciamento gênico
    by Moreira, Adriana Gonçalves
    Published 2017
    “... restriction enzymes, derived from the pKS+ plasmid vector. This viral vector will be a complement...”
    Get full text
  13. 2753
    Detecção e caracterização molecular de um fitoplasma do grupo 16SrIII associado ao amarelo da videira na região serrana do Rio Grande do Sul
    by Santos, Ronize Rohr dos
    Published 2016
    “... for RFLP analysis in silico, with 17 restriction enzymes, and phylogenetic analysis. Phytoplasmas were...”
    Get full text
  14. 2754
    Diversidade genética e associação do gene do choque térmico (HSP-70.1) ao desempenho produtivo em vacas leiteiras no semiárido
    by ARAÚJO, Maria das Dores Silva
    Published 2017
    “..., digestion with restriction enzymes (EcoRII) followed by electrophoresis and photo documentation. We...”
    Get full text
    Others
  15. 2755
    Caracterização de bactérias láticas da microbiota de grãos de Kefir cultivados em leite ou água com açúcar mascavo por metodologias dependentes e independentes de cultivos
    by Débora Ferreira Zanirati
    Published 2012
    “.... The amplicons of fifty transformant colonies were separately digested with restriction enzymes TaqI and Sau 3AI...”
    Get full text
    Others
  16. 2756
    Incidência de enteroparasitas com caracterização molecular de Cryptosporidium spp. em diferentes comunidades brasileiras
    “... restriction enzymes. Double PCR confirmed Cryptosporidium in 37.2% (83/223) of the analyzed fecal samples...”
    Get full text
    Others
  17. 2757
    Estudo do gene LHX4 em pacientes com hipopituitarismo associado a neuro-hipófise ectópica
    by Melo, Maria Edna de
    Published 2005
    “... with restriction enzymes. RESULTS: The pituitary stalk was visualized in 21 patients; of these, 10 (48%) exhibited...”
    Get full text
    Others
  18. 2758
    Caracterização molecular e perfil de sensibilidade de Candida tropicalis isoladas em corrente sanguínea e cateter de pacientes internados em hospitais de ensino
    “... discriminatory power index of P1 and P2 primers than P3 by RAPD analysis. PFGE was performed with restriction...”
    Get full text
    Others
  19. 2759
    Molecular mechanisms of the carcinogen chromium(VI)-induced DNA-protein crosslinking in cultured intact human cells
    by Mattagajasingh, Subhendra N.
    Published 2014
    “... in the fractionation of DNA by restriction enzymes as compared to that isolated from cells treated with chromate alone...”
    Get full text
    Get full text
    Others
  20. 2760
    Isolamento e caracteriza??o de Cyniclomyces guttulatus (Robin) Van Der Walt e Scott (1971) de c?es procedentes da Barra da Tijuca, Rio de Janeiro, RJ
    by Furtado, Tassia torres
    Published 2017
    “... with the restriction enzymes DdeI, HaeIII and MspI would allow the differential identification of C. guttulatus...”
    Get full text
    Others
Search Tools: Get RSS Feed — Email this Search