Suggested Topics within your search.
Showing 2,721 - 2,740 results of 2,853 for search '"restriction enzyme"', query time: 0.98s Refine Results
  1. 2721
    A colonização por Pneumocystis jirovecii em pacientes com fibrose cística
    by Pederiva, Marco Aurélio
    Published 2011
    “... and the mitochondrial Large Subunit ribosomal RNA (mtLSUrRNA) was performed with the use of restriction enzymes...”
    Get full text
    Others
  2. 2722
    Detecção de possíveis agentes virais associados à circovirose suína.
    by Teixeira, Thais Fumaco
    Published 2008
    “... is cleaved with restriction enzymes, so giving rise to large amounts of linearized copies of the original...”
    Get full text
    Others
  3. 2723
    Detección de SNP en genes CYP2C8 de pacientes con cáncer de mama que reciben paclitaxel en el Instituto Nacional de Enfermedades Neoplásicas de marzo a diciembre 2013
    “... in exon 8. The amplified products were cut with restriction enzymes BclI and PdmI (XmnI) for CYP2C8*2...”
    Get full text
  4. 2724
    Esteato-hepatite não alcoólica: avaliação clínica, laboratorial, histopatológica e pesquisa de mutações do gene HFE: casuística de um centro de referência
    by Marta Mitiko Deguti
    Published 2000
    “... mutations in 31 of these individuals were searched using PCR-RFLP techniques, using restriction enzymes SnaB...”
    Get full text
  5. 2725
    Detecção de possíveis agentes virais associados à circovirose suína.
    by Teixeira, Thais Fumaco
    Published 2008
    “... is cleaved with restriction enzymes, so giving rise to large amounts of linearized copies of the original...”
    Get full text
    Others
  6. 2726
    A colonização por Pneumocystis jirovecii em pacientes com fibrose cística
    by Pederiva, Marco Aurélio
    Published 2011
    “... and the mitochondrial Large Subunit ribosomal RNA (mtLSUrRNA) was performed with the use of restriction enzymes...”
    Get full text
    Others
  7. 2727
    Caracterização molecular de um fitoplasma associado ao superbrotamento do melão-de-São-Caetano (Momordica charantia L) com base nas sequências dos genes 16S rRNA e secY
    by Elizeu Merizio Munhoz
    Published 2013
    “... analysis, performed with the genomic fragment corresponding to the gene secY and various restriction...”
    Get full text
  8. 2728
    Análise citogenética de espécies do gênero Hypostomus (Loricariidae; Hypostominae) das bacias do rio Contas e Recôncavo Sul/Bahia
    by Jamille de Araújo Bitencourt
    Published 2010
    “... after C-banding, fluorochrome staining and digestion with the restriction enzymes Alu I, Bam HI, Hae III...”
    Get full text
  9. 2729
    Esteato-hepatite não alcoólica: avaliação clínica, laboratorial, histopatológica e pesquisa de mutações do gene HFE: casuística de um centro de referência
    by Deguti, Marta Mitiko
    Published 2000
    “... mutations in 31 of these individuals were searched using PCR-RFLP techniques, using restriction enzymes SnaB...”
    Get full text
    Others
  10. 2730
    Detecção e identificação molecular de um fitoplasma do grupo 16SrIII em plantas de maçã com sintomas de lenho mole.
    “...(III) F2/R1 primers and RFLP technique with the restriction enzymes Alu I, Hha I, Kpn I, Hinf I, Hpa...”
    Get full text
    Others
  11. 2731
    Desenvolvimento e validação de método para a identificação de micro-organismos metabolicamente ativos em biofilmes de amostras ambientais através da análise de rRNA 16S.
    by Nammoura Neto, Georges Mikhael
    Published 2018
    “... contaminants that interfere with Taq polymerase activity and restriction enzymes. After the sequencing...”
    Get full text
    Others
  12. 2732
    Isolamento e caracterização de clones da família de glicoproteínas (Tc-85) de Trypanosoma cruzi
    by Oliveira, Débora Rose de
    Published 2000
    “...\') TCACAAAGTCGCAAAGCCCCACAGTCC was cut with restriction enzymes resulting in fragments of the expected size (~2-2.5 kb) in 91...”
    Get full text
    Others
  13. 2733
    Caracterização molecular de um fitoplasma associado ao superbrotamento do melão-de-São-Caetano (Momordica charantia L) com base nas sequências dos genes 16S rRNA e secY
    by Munhoz, Elizeu Merizio
    Published 2013
    “... analysis, performed with the genomic fragment corresponding to the gene secY and various restriction...”
    Get full text
    Others
  14. 2734
    Collection, isolation and classification of marine vibrios from coastal waters in Taiwan
    by Hsiu-Hui Chiu, 邱秀慧
    Published 2006
    “... genotypes according to the analysis of 16S rRNA-RFLP digested with various restriction enzymes (DdeI, HhaI...”
    Get full text
    Others
  15. 2735
    A molecular, morphological and biological characterisation of the genus Globodera (Nematoda: Heteroderidae) in South Africa
    by Knoetze, Rinus
    Published 2014
    “... for the accurate identification of South African cyst nematodes, species-specific primers and restriction enzymes...”
    Get full text
    Others
  16. 2736
    Variabilidade genética e ecológica de Drosophila willistoni (Diptera, Drosophilidae) : uma abordagem molecular através do isolamento e caracterização de fragmentos heterogêneos de DNA
    by Garcia, Rosane Nunes
    Published 2008
    “... of genomic DNA of males and females with the restriction enzymes AluI e HaeIII. These results demonstrated...”
    Get full text
    Others
  17. 2737
    Prevalência do polimorfismo R72P no gene TP53 E C677T / A1298C do gene da metilenotetrahidrofolato redutase (MTHFR) em mulheres judias ashkenazi de Porto Alegre
    “... followed by digestion with specific restriction enzymes. The R72P polymorphism showed a genotype frequency...”
    Get full text
    Others
  18. 2738
    Production of Cydia pomonella granulovirus (CpGV) in a heteralogous host, Thaumatotibia Leucotreta (Meyrick) (False codling moth)
    by Chambers, Craig Brian
    Published 2015
    “.... Characterisation of DNA profiles using a variety of restriction enzymes revealed that only a single isolate, CpGV...”
    Get full text
    Others
  19. 2739
    Caracterização da diversidade epigenética de cana-de-açúcar via MSAP (Methylation Sensitive Amplification Polymorphism)
    by Martins, Alessandra Alves
    Published 2018
    “... with the restriction enzymes EcoRI-MspI and EcoRI-HpaII, ligated to adapters followed by pre-selective and selective...”
    Get full text
  20. 2740
    Variabilidade genética e ecológica de Drosophila willistoni (Diptera, Drosophilidae) : uma abordagem molecular através do isolamento e caracterização de fragmentos heterogêneos de DNA
    by Garcia, Rosane Nunes
    Published 2008
    “... of genomic DNA of males and females with the restriction enzymes AluI e HaeIII. These results demonstrated...”
    Get full text
    Others
Search Tools: Get RSS Feed — Email this Search