<i>TRIM39-RPP21</i> Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses

• Main Authors: Victor N. Rivas, Monica Aleman, Janel A. Peterson, Anna R. Dahlgren, Erin N. Hales, Carrie J. Finno
• Format: Article
• Language: English
• Published: MDPI AG 2019-10-01
• Series: Genes
• Subjects: convulsion; electroencephalogram; equine; seizure
• Online Access: https://www.mdpi.com/2073-4425/10/10/816

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA&gt;TATCTTAAGACCC) of the <i>Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit</i> (<i>TRIM39-RPP21</i>) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (<i>P</i> = 1.00) or allelic (<i>P</i> = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in <i>TRIM39-RPPB1</i> are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.